Gelecekte zenginlik GEN’lerde!

Bilgiyi aktarma, kullanma ve çoğaltma işi, mağara duvarlarına kazınan resimlerden başlamış; çiviyazısı, resimyazı ve Latin alfabesine kadar uzanmış. Şimdilerde kullandığımız alfabe ise 1 ve 0.

Gelecekte zenginlik GEN’lerde!
Gelecekte zenginlik GEN’lerde!
GİRİŞ 26.02.2008 08:59 GÜNCELLEME 26.02.2008 08:59

Ufuk Tarhan

Bilgiyi aktarma, kullanma ve çoğaltma işi, mağara duvarlarına kazınan resimlerden başlamış; çiviyazısı, resimyazı ve Latin alfabesine kadar uzanmış. Alfabe neredeyse, alemin kralı o toplum olmuş! Şimdilerde kullandığımız alfabe ne? A, B, C mi diyorsunuz? Hayır! Artık, alfabemiz 1 ve 0.

Milenyum insanlarının çoğu, neredeyse dünyanın ana dili haline gelen 1 ve 0’dan ibaret iki sembollük dijital alfabe kullanıyor. İnsanlar bu alfabeyle "ses, görüntü ve bilgiyi" inanılmaz hız ve doğrulukla iletiyor. Sihir gibi bir şey bu alfabe. Dijital olarak telefon sesi ilettiğinde, "Merhaba"yı duyduğumuzda, geri plandaki kodlama sisteminde 01000100 00110110 11011011 00010110 11011011 10011000 11110011 yazıyor. Birkaç 1 ve 0 yer değiştirince ise mesaj "Güle güle", 11001100 10000010 11100011 10101000 10001010 00000011 11100111 00010001 00000001 oluyor.

Sadece iki rakamın konumu değiştirilerek yaratılan yeni bilgi platformu, sosyal, psikolojik, ekonomik, teknolojik, vs. alanlarda her şeyi inanılmaz hızla değiştirdi, değiştiriyor. Peki bu, gelebileceğimiz son nokta mı? Tabii ki hayır! Yeni egemen alfabe ATCG olacak! Nasıl mı?

2001’de, insanın genetik şifresinin, DNA’sının (deoksiribonükleik asit) yapısı çözüldü! Nedir bu DNA dedikleri? Tüm yaşam biçimlerinin kodlarını içinde barındıran bir molekül. DNA, iplerle bağlanmış, kendi ekseninde dönen bir asma merdivene benziyor. Molekülün kenarları, şeker ve fosfattan, basamakları da 4 maddeden oluşuyor: Adenin-A, Timin-T, Sitozin-C, Guanine-G. Kısaca ATCG. 1995’ten bu yana, bilim insanlarının gündeminde.

Her canlı, hücresinde, o canlının genetik kodunu taşıyor. Bizim genetik kodumuzda, üç milyar harf (A, T, C, G) var ve bu kod, sahip olduğumuz elli trilyon hücrenin her birinin içinde tekrarlanıyor. Nasıl SARP kelimesini yeniden dizip PARS, DORMITORY kelimesini yeniden dizip DIRTY ROOM, 0 ve 1’lerin yerini değiştirdiğimizde ise GÜLE GÜLE ya da MERHABA örneğindeki gibi farklı sonuçlar elde ediyorsak, ATCG dizisini değiştirdiğimizde de organizma tepeden tırnağa değişiyor!

İnsan genleri, solucanlarınkilerden üçte bir oranında fazla. Genlerimizin yüzde 99’unun karşılığı, bir biçimde farelerde var. Bu yüzden fare, en fazla kullanılan denek hayvanı. Şempanzelerin bir türünün DNA’sı, insanınkiyle yüzde 98,5 oranında örtüşüyor. Genomdaki küçük değişiklikler, insanları uzun, kısa, şişman, ince, sarışın, kızıl, sağlıklı ya da çok hasta yapmaya yetiyor. Üç milyon harften oluşan sıtma kodunun içindeki bir A harfi yerine G harfi koyulursa, hastalık öldürücü hale geliyor.


Şuraya geliyoruz. Gezegendeki tüm canlıları kodlayan bu dili -genetik alfabeyi- anlamayı ve kullanmayı başaran bireyler, kurumlar, topluluklar ve ülkeler, idareyi ele geçirecek Geleceğin zenginleri ve hükmedenleri onlar olacak. Dünyadaki patent savaşlarının sebebi budur.

Geçen yıl, bir konuşma için gittiğim ve gelecek için umutsuz bir hava içinde olduklarını algıladığım genetik fakültesi öğrencilerinin bu yazıyı okumalarını ve ne kadar kıymetli bir dalda ilerlediklerini anlamalarını dilerim. Bu dallara hâlâ önem vermeyenlerin durumu fark etmelerini ise Tanrı'dan niyaz ederim!


Diğer bölümlerde okuyan gençlere de muhakkak mesleklerinin genetikle ilgili buluşma noktalarını gözlemelerini öneririm. Örneğin, genetik laboratuvarı ya da şirketi sözleşmeleri, hukuku vs. üzerinde uzman bir avukat, 20 yıl sonra ne demek olacak, hayal edebiliyor musunuz? Ya genetik laboratuvarı inşasında, makine imalatında ve tasarımında uzman mühendisler?


Konunun başlığı, sanırım bu noktada iyi bir yazı sonu olacak: Gelecekte zenginlik GEN’de, gelecek de peşinizde!
Kaynak: Juan Enriquez, "Gelecek Peşinizde"

Şüphesi olanlara, aşağıda 03. 02. 2008 tarihli gazete haberini hatırlatıyorum:

DNA’nın üstüne imzasını atmış!

İlk kez bir bakterinin sentetik genomunu (DNA dizilimi) oluşturup bunu yakında canlı bir hücreye yerleştirerek tarihteki 'ilk yapay organizma'yı yaratmaya hazırlanan Amerikalı biyolog ve girişimci Craig Venter’ın, söz konusu DNA’nın genetik koduna kendi ismini yazdığı ortaya çıktı.


Altmış bir yaşındaki bilimadamı ve girişimci Craig Venter, kimyasal maddeler kullanarak yarattığı ilk sentetik genomun 'filigran' olarak bilinen genetik kod dizilerinden birine, açılımı 'Craig Venter' olan 'TTAACTAGCTA ATGTCGTGCAATTGGAGTAG AGAACACAGAACG ATTAACTAGCTAA' şifresini yerleştirdi. Venter, daha önce de insanın genetik şifresini çözmek için başladığı çalışmada kendi DNA’sını kullanarak tartışma yaratmıştı.








YAZDIR
YORUMLAR İLK YORUM YAPAN SEN OL
DİĞER HABERLER
KARA Atmaca devreye giriyor: Yunanistan için artık imkansız
ABD'de polis yine dehşet saçtı